negative control scrambled sirna Search Results


95
OriGene control scrambled shrna
Fig. 3. P2Y1 silencing impairs ADP-dependent axon elongation. (A) Hippocampal neurons were nucleofected with scrambled <t>shRNA,</t> P2Y1 shRNA or P2Y13 shRNA. Neurons were fixed at 3 DIV and stained with an anti-a-tubulin antibody. Nucleofected neurons were identified by their GFP fluorescence. (B) HEK- 293T cells were co-transfected with GFP, P2Y1–GFP or P2Y13 plasmids, in combination with different P2Y1 or <t>P2Y13</t> <t>shRNAs.</t> Data are means ± s.e.m. of three independent experiments. P2Y1–GFP and P2Y13 protein expression was normalized to a-tubulin expression levels; ***P,0.001. (C) Axon length of hippocampal neurons expressing scrambled shRNA, two different P2Y1 shRNAs or two different P2Y13 shRNAs was quantified after staining with antibodies against MAP2 and Tau-1. Data are mean axon lengths ± s.e.m. from three independent experiments, analyzing 100 neurons for each condition in each experiment; ***P,0.001. The dotted grey line indicates the mean axon length of scrambled-shRNA-nucleofected neurons. (D,E) Hippocampal neurons nucleofected with scrambled shRNA or P2Y1 shRNA and treated with ADP (5 mM) from day 1 to day 3 in vitro. The graph in D shows the axon length in nucleofected neurons (GFP-positive) incubated in the presence or absence of ADP. (F–H) Hippocampal neurons nucleofected with scrambled shRNA, P2Y1 shRNA or P2Y13 shRNA and treated with the P2Y1 antagonist (MRS-2179) or the P2Y13 antagonist (MRS-2211) from day 1 to day 3 in vitro. Scale bars: 50 mm. Note that in all cases P2Y1 expression and function is necessary for axon elongation. Data in G are the mean axon lengths ± s.e.m. from three independent experiments, analyzing 100 neurons for each condition in each experiment; ***P,0.001. H shows the distribution of the axon length for all neurons from three independent experiments for each condition (n5300). (I) Hippocampal neurons that had been nucleofected with plasmids expressing GFP, P2Y1–GFP and P2Y13. After 3 DIV neurons were stained for MAP2 and Tau-1 to identify the axon. (J) P2Y1 or P2Y13 mean fluorescence intensity along the axon in control, scrambled shRNA, P2Y1 shRNA or P2Y13 shRNA nucleofected neurons. (K) Graph of the mean axon lengths ± s.e.m. of neurons nucleofected with GFP, P2Y1–GFP or P2Y13 and GFP. Neurons were quantified in three independent experiments, analyzing 100 neurons for each condition in each experiment; ***P,0.001. Scale bars: 100 mm. Box-plot shows the distribution of axon lengths for all the neurons quantified in K.
Control Scrambled Shrna, supplied by OriGene, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/negative+control+scrambled+sirna/Scrambled+shRNA+control+in+pRS+shRNA+Vector/pm22250198-272-10-16
Average 95 stars, based on 1 article reviews
control scrambled shrna - by Bioz Stars, 2026-09
95/100 stars
  Buy from Supplier

95
OriGene pgfp v rs ca v 1 2 shrna
Fig. 3. P2Y1 silencing impairs ADP-dependent axon elongation. (A) Hippocampal neurons were nucleofected with scrambled <t>shRNA,</t> P2Y1 shRNA or P2Y13 shRNA. Neurons were fixed at 3 DIV and stained with an anti-a-tubulin antibody. Nucleofected neurons were identified by their GFP fluorescence. (B) HEK- 293T cells were co-transfected with GFP, P2Y1–GFP or P2Y13 plasmids, in combination with different P2Y1 or <t>P2Y13</t> <t>shRNAs.</t> Data are means ± s.e.m. of three independent experiments. P2Y1–GFP and P2Y13 protein expression was normalized to a-tubulin expression levels; ***P,0.001. (C) Axon length of hippocampal neurons expressing scrambled shRNA, two different P2Y1 shRNAs or two different P2Y13 shRNAs was quantified after staining with antibodies against MAP2 and Tau-1. Data are mean axon lengths ± s.e.m. from three independent experiments, analyzing 100 neurons for each condition in each experiment; ***P,0.001. The dotted grey line indicates the mean axon length of scrambled-shRNA-nucleofected neurons. (D,E) Hippocampal neurons nucleofected with scrambled shRNA or P2Y1 shRNA and treated with ADP (5 mM) from day 1 to day 3 in vitro. The graph in D shows the axon length in nucleofected neurons (GFP-positive) incubated in the presence or absence of ADP. (F–H) Hippocampal neurons nucleofected with scrambled shRNA, P2Y1 shRNA or P2Y13 shRNA and treated with the P2Y1 antagonist (MRS-2179) or the P2Y13 antagonist (MRS-2211) from day 1 to day 3 in vitro. Scale bars: 50 mm. Note that in all cases P2Y1 expression and function is necessary for axon elongation. Data in G are the mean axon lengths ± s.e.m. from three independent experiments, analyzing 100 neurons for each condition in each experiment; ***P,0.001. H shows the distribution of the axon length for all neurons from three independent experiments for each condition (n5300). (I) Hippocampal neurons that had been nucleofected with plasmids expressing GFP, P2Y1–GFP and P2Y13. After 3 DIV neurons were stained for MAP2 and Tau-1 to identify the axon. (J) P2Y1 or P2Y13 mean fluorescence intensity along the axon in control, scrambled shRNA, P2Y1 shRNA or P2Y13 shRNA nucleofected neurons. (K) Graph of the mean axon lengths ± s.e.m. of neurons nucleofected with GFP, P2Y1–GFP or P2Y13 and GFP. Neurons were quantified in three independent experiments, analyzing 100 neurons for each condition in each experiment; ***P,0.001. Scale bars: 100 mm. Box-plot shows the distribution of axon lengths for all the neurons quantified in K.
Pgfp V Rs Ca V 1 2 Shrna, supplied by OriGene, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/negative+control+scrambled+sirna/Scrambled+shRNA+control+in+pGFP-V-RS+shRNA+Vector/bio_rxiv__64898__2025__12__11__693636-221-0-9
Average 95 stars, based on 1 article reviews
pgfp v rs ca v 1 2 shrna - by Bioz Stars, 2026-09
95/100 stars
  Buy from Supplier

96
OriGene shrna
Fig. 3. P2Y1 silencing impairs ADP-dependent axon elongation. (A) Hippocampal neurons were nucleofected with scrambled <t>shRNA,</t> P2Y1 shRNA or P2Y13 shRNA. Neurons were fixed at 3 DIV and stained with an anti-a-tubulin antibody. Nucleofected neurons were identified by their GFP fluorescence. (B) HEK- 293T cells were co-transfected with GFP, P2Y1–GFP or P2Y13 plasmids, in combination with different P2Y1 or <t>P2Y13</t> <t>shRNAs.</t> Data are means ± s.e.m. of three independent experiments. P2Y1–GFP and P2Y13 protein expression was normalized to a-tubulin expression levels; ***P,0.001. (C) Axon length of hippocampal neurons expressing scrambled shRNA, two different P2Y1 shRNAs or two different P2Y13 shRNAs was quantified after staining with antibodies against MAP2 and Tau-1. Data are mean axon lengths ± s.e.m. from three independent experiments, analyzing 100 neurons for each condition in each experiment; ***P,0.001. The dotted grey line indicates the mean axon length of scrambled-shRNA-nucleofected neurons. (D,E) Hippocampal neurons nucleofected with scrambled shRNA or P2Y1 shRNA and treated with ADP (5 mM) from day 1 to day 3 in vitro. The graph in D shows the axon length in nucleofected neurons (GFP-positive) incubated in the presence or absence of ADP. (F–H) Hippocampal neurons nucleofected with scrambled shRNA, P2Y1 shRNA or P2Y13 shRNA and treated with the P2Y1 antagonist (MRS-2179) or the P2Y13 antagonist (MRS-2211) from day 1 to day 3 in vitro. Scale bars: 50 mm. Note that in all cases P2Y1 expression and function is necessary for axon elongation. Data in G are the mean axon lengths ± s.e.m. from three independent experiments, analyzing 100 neurons for each condition in each experiment; ***P,0.001. H shows the distribution of the axon length for all neurons from three independent experiments for each condition (n5300). (I) Hippocampal neurons that had been nucleofected with plasmids expressing GFP, P2Y1–GFP and P2Y13. After 3 DIV neurons were stained for MAP2 and Tau-1 to identify the axon. (J) P2Y1 or P2Y13 mean fluorescence intensity along the axon in control, scrambled shRNA, P2Y1 shRNA or P2Y13 shRNA nucleofected neurons. (K) Graph of the mean axon lengths ± s.e.m. of neurons nucleofected with GFP, P2Y1–GFP or P2Y13 and GFP. Neurons were quantified in three independent experiments, analyzing 100 neurons for each condition in each experiment; ***P,0.001. Scale bars: 100 mm. Box-plot shows the distribution of axon lengths for all the neurons quantified in K.
Shrna, supplied by OriGene, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/negative+control+scrambled+sirna/Scrambled+shRNA+control+in+pGFP-C-shLenti+shRNA+Vector/10__1161_slash_jaha__117__007457-36-6-24
Average 96 stars, based on 1 article reviews
shrna - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier

95
MedChemExpress control sirna
( A and B ) Quantitative proteomic analysis of the mouse cerebrum. (A) Proteomic analysis of the mouse cerebrum and a volcano plot illustrating down-regulated (blue) and up-regulated (red) proteins in the cerebra of 6-month-old 5×FAD; Usp25 −/− versus 5×FAD mice (fold change > 1.1, P < 0.05). n = 3 samples per group; each sample is a pool of three cerebra from the same genotype. (B) GO analysis of down-regulated proteins in 5×FAD; Usp25 −/− mice relative to 5×FAD mice. ( C ) Primary microglia from WT mice were transfected with siAtp6v0c or control <t>siRNA</t> (siNC) for 48 hours and subsequently treated with 10 μM oAβ 42 or vehicle control along with pHrodo Red–labeled synaptosomes (Syn) for another 24 hours, and the phagocytosis abilities of microglia were quantified on the basis of the pHrodo Red intensity in Iba1 + cells. Scale bar, 25 μm. n = 3 independent experiments; n = 207 to 211 cells per group were counted. ( D and E ) Coimmunoprecipitation (IP) between exogenously expressed USP25a-myc and HA-ATP6V0C (D) or HA-WDFY1 (E) proteins. ( F and G ) Immunoblot (IB) analysis of polyubiquitinated HA-ATP6V0C (F) and HA-WDFY1 (G) <t>in</t> <t>HEK293T</t> cells upon USP25 knockdown. n = 6. All data represent means ± SEM. P values were determined by the Kruskal-Wallis test with Dunn’s post hoc analysis in (C) and by the Mann-Whitney test in (F) and (G). * P < 0.05; ** P < 0.01; **** P < 0.0001.
Control Sirna, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/negative+control+scrambled+sirna/SiRNA+Negative+Control/pmc07775784-143-6-19
Average 95 stars, based on 1 article reviews
control sirna - by Bioz Stars, 2026-09
95/100 stars
  Buy from Supplier

93
OriGene scramble sirna
Fig. 5. Effects of plasmin <t>on</t> <t>PDGF-D</t> induced inflammation. The plasmin antagonist (EACA) decreased ICH induced production of PDGF-D and p-PDGFRβ increases 24 h after ICH (A, #p b 0.05 vs sham. *p b 0.05 vs ICH. n = 6 mice per group), resulting in decreased microglia activation (B). Injection of the recombinant plasmin induced significant production of the PDGF-D in ipsilateral hemisphere (C, #p b 0.05 vs sham, @p b 0.05 vs contralateral. n = 6 mice per group). Increased MPO levels (D) were also observed after plasmin injection. While scrambled RNA has no effect, PDGF-D <t>siRNA</t> attenuated plasmin induced increase of MPO production (D, #p b 0.05 vs sham. αp b 0.05 vs Plasmin. n = 6 mice per group). Error bars represent mean ± standard error of the mean. Scale bar = 50um.
Scramble Sirna, supplied by OriGene, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/negative+control+scrambled+sirna/Scrambled+shRNA+control+in+pRFP-C-RS+shRNA+Vector/pm27302678-66-7-14
Average 93 stars, based on 1 article reviews
scramble sirna - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

91
OriGene scr shrna pgfp b rs
Fig. 5. Effects of plasmin <t>on</t> <t>PDGF-D</t> induced inflammation. The plasmin antagonist (EACA) decreased ICH induced production of PDGF-D and p-PDGFRβ increases 24 h after ICH (A, #p b 0.05 vs sham. *p b 0.05 vs ICH. n = 6 mice per group), resulting in decreased microglia activation (B). Injection of the recombinant plasmin induced significant production of the PDGF-D in ipsilateral hemisphere (C, #p b 0.05 vs sham, @p b 0.05 vs contralateral. n = 6 mice per group). Increased MPO levels (D) were also observed after plasmin injection. While scrambled RNA has no effect, PDGF-D <t>siRNA</t> attenuated plasmin induced increase of MPO production (D, #p b 0.05 vs sham. αp b 0.05 vs Plasmin. n = 6 mice per group). Error bars represent mean ± standard error of the mean. Scale bar = 50um.
Scr Shrna Pgfp B Rs, supplied by OriGene, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/negative+control+scrambled+sirna/Scrambled+shRNA+control+in+pGFP-B-RS+shRNA+Vector/10__1158_slash_0008___5472__can___16___1666-32-23-24
Average 91 stars, based on 1 article reviews
scr shrna pgfp b rs - by Bioz Stars, 2026-09
91/100 stars
  Buy from Supplier

90
Xeragon Inc fluorescence-labelled control, scrambled and human p140cap-specific sirnas (aagctgtgtctgttgaggctg)
Fig. 5. Effects of plasmin <t>on</t> <t>PDGF-D</t> induced inflammation. The plasmin antagonist (EACA) decreased ICH induced production of PDGF-D and p-PDGFRβ increases 24 h after ICH (A, #p b 0.05 vs sham. *p b 0.05 vs ICH. n = 6 mice per group), resulting in decreased microglia activation (B). Injection of the recombinant plasmin induced significant production of the PDGF-D in ipsilateral hemisphere (C, #p b 0.05 vs sham, @p b 0.05 vs contralateral. n = 6 mice per group). Increased MPO levels (D) were also observed after plasmin injection. While scrambled RNA has no effect, PDGF-D <t>siRNA</t> attenuated plasmin induced increase of MPO production (D, #p b 0.05 vs sham. αp b 0.05 vs Plasmin. n = 6 mice per group). Error bars represent mean ± standard error of the mean. Scale bar = 50um.
Fluorescence Labelled Control, Scrambled And Human P140cap Specific Sirnas (Aagctgtgtctgttgaggctg), supplied by Xeragon Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/negative+control+scrambled+sirna/fluorescence+labelled+control++scrambled+and+human+p140cap+specific+sirnas++aagctgtgtctgttgaggctg+/pmc01894765-362-7-9
Average 90 stars, based on 1 article reviews
fluorescence-labelled control, scrambled and human p140cap-specific sirnas (aagctgtgtctgttgaggctg) - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
BONAC Corporation negative control sirna
Fig. 5. Effects of plasmin <t>on</t> <t>PDGF-D</t> induced inflammation. The plasmin antagonist (EACA) decreased ICH induced production of PDGF-D and p-PDGFRβ increases 24 h after ICH (A, #p b 0.05 vs sham. *p b 0.05 vs ICH. n = 6 mice per group), resulting in decreased microglia activation (B). Injection of the recombinant plasmin induced significant production of the PDGF-D in ipsilateral hemisphere (C, #p b 0.05 vs sham, @p b 0.05 vs contralateral. n = 6 mice per group). Increased MPO levels (D) were also observed after plasmin injection. While scrambled RNA has no effect, PDGF-D <t>siRNA</t> attenuated plasmin induced increase of MPO production (D, #p b 0.05 vs sham. αp b 0.05 vs Plasmin. n = 6 mice per group). Error bars represent mean ± standard error of the mean. Scale bar = 50um.
Negative Control Sirna, supplied by BONAC Corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/negative+control+scrambled+sirna/negative+control+sirna/pm23221504-44-11-18
Average 90 stars, based on 1 article reviews
negative control sirna - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Ribobio co negative control sirna (sinc)
Fig. 5. Effects of plasmin <t>on</t> <t>PDGF-D</t> induced inflammation. The plasmin antagonist (EACA) decreased ICH induced production of PDGF-D and p-PDGFRβ increases 24 h after ICH (A, #p b 0.05 vs sham. *p b 0.05 vs ICH. n = 6 mice per group), resulting in decreased microglia activation (B). Injection of the recombinant plasmin induced significant production of the PDGF-D in ipsilateral hemisphere (C, #p b 0.05 vs sham, @p b 0.05 vs contralateral. n = 6 mice per group). Increased MPO levels (D) were also observed after plasmin injection. While scrambled RNA has no effect, PDGF-D <t>siRNA</t> attenuated plasmin induced increase of MPO production (D, #p b 0.05 vs sham. αp b 0.05 vs Plasmin. n = 6 mice per group). Error bars represent mean ± standard error of the mean. Scale bar = 50um.
Negative Control Sirna (Sinc), supplied by Ribobio co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/negative+control+scrambled+sirna/negative+control+sirna/10__7554_slash_elife__42426-395-6-19
Average 90 stars, based on 1 article reviews
negative control sirna (sinc) - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Ribobio co sirna of arg2, ho-1, creb1 and their matched scramble control
Fig. 5. Effects of plasmin <t>on</t> <t>PDGF-D</t> induced inflammation. The plasmin antagonist (EACA) decreased ICH induced production of PDGF-D and p-PDGFRβ increases 24 h after ICH (A, #p b 0.05 vs sham. *p b 0.05 vs ICH. n = 6 mice per group), resulting in decreased microglia activation (B). Injection of the recombinant plasmin induced significant production of the PDGF-D in ipsilateral hemisphere (C, #p b 0.05 vs sham, @p b 0.05 vs contralateral. n = 6 mice per group). Increased MPO levels (D) were also observed after plasmin injection. While scrambled RNA has no effect, PDGF-D <t>siRNA</t> attenuated plasmin induced increase of MPO production (D, #p b 0.05 vs sham. αp b 0.05 vs Plasmin. n = 6 mice per group). Error bars represent mean ± standard error of the mean. Scale bar = 50um.
Sirna Of Arg2, Ho 1, Creb1 And Their Matched Scramble Control, supplied by Ribobio co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/negative+control+scrambled+sirna/sirna+of+arg2++ho+1++creb1+and+their+matched+scramble+control/pm37856999-80-4-14
Average 90 stars, based on 1 article reviews
sirna of arg2, ho-1, creb1 and their matched scramble control - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Ribobio co pfn1 sirna
<t>PFN1</t> is correlated with NSCLC metastasis and could promote NSCLC cell migration in vitro . (A) Representative IHC images of PFN1 expression on the NSCLC tissues. (B) The staining index of PFN1 on the tissue chip. ** p < 0.01. (C) Representative IHC images of PFN1 expression on the tissue chip. (D) The expression of PFN1 in TCGA LUAD data. ** p < 0.01. (E) The Kaplan–Meier survival analysis of PFN1 in NSCLC patients. (Data source: TCGA LUAD dataset) (F,G) Wound healing assays conducted to evaluate the migration ability of PFN1 -overexpressing (F) and PFN1 knockdown (KD) (G) H1299 cells. ** p < 0.01; scale bar, 500 μm. (H,I) Transwell migration assays conducted to evaluate the migration of PFN1 -overexpressing (H) and PFN1 KD (I) H1299 cells. ** p < 0.01; scale bar, 500 μm. EV, empty vector; OE, PFN1 overexpression; NC, negative control; si-1/ 2, PFN1 siRNA1 1/2.
Pfn1 Sirna, supplied by Ribobio co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/negative+control+scrambled+sirna/sirnas+for+pfn1+and+cdc42+knockdown+and+negative+control+sequences++si+nc+/pmc09108340-61-0-10
Average 90 stars, based on 1 article reviews
pfn1 sirna - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
siTools Biotech negative control sirna pool
<t>PFN1</t> is correlated with NSCLC metastasis and could promote NSCLC cell migration in vitro . (A) Representative IHC images of PFN1 expression on the NSCLC tissues. (B) The staining index of PFN1 on the tissue chip. ** p < 0.01. (C) Representative IHC images of PFN1 expression on the tissue chip. (D) The expression of PFN1 in TCGA LUAD data. ** p < 0.01. (E) The Kaplan–Meier survival analysis of PFN1 in NSCLC patients. (Data source: TCGA LUAD dataset) (F,G) Wound healing assays conducted to evaluate the migration ability of PFN1 -overexpressing (F) and PFN1 knockdown (KD) (G) H1299 cells. ** p < 0.01; scale bar, 500 μm. (H,I) Transwell migration assays conducted to evaluate the migration of PFN1 -overexpressing (H) and PFN1 KD (I) H1299 cells. ** p < 0.01; scale bar, 500 μm. EV, empty vector; OE, PFN1 overexpression; NC, negative control; si-1/ 2, PFN1 siRNA1 1/2.
Negative Control Sirna Pool, supplied by siTools Biotech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/negative+control+scrambled+sirna/negative+control+sirna/pmc07826283-61-14-18
Average 90 stars, based on 1 article reviews
negative control sirna pool - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

Image Search Results


Fig. 3. P2Y1 silencing impairs ADP-dependent axon elongation. (A) Hippocampal neurons were nucleofected with scrambled shRNA, P2Y1 shRNA or P2Y13 shRNA. Neurons were fixed at 3 DIV and stained with an anti-a-tubulin antibody. Nucleofected neurons were identified by their GFP fluorescence. (B) HEK- 293T cells were co-transfected with GFP, P2Y1–GFP or P2Y13 plasmids, in combination with different P2Y1 or P2Y13 shRNAs. Data are means ± s.e.m. of three independent experiments. P2Y1–GFP and P2Y13 protein expression was normalized to a-tubulin expression levels; ***P,0.001. (C) Axon length of hippocampal neurons expressing scrambled shRNA, two different P2Y1 shRNAs or two different P2Y13 shRNAs was quantified after staining with antibodies against MAP2 and Tau-1. Data are mean axon lengths ± s.e.m. from three independent experiments, analyzing 100 neurons for each condition in each experiment; ***P,0.001. The dotted grey line indicates the mean axon length of scrambled-shRNA-nucleofected neurons. (D,E) Hippocampal neurons nucleofected with scrambled shRNA or P2Y1 shRNA and treated with ADP (5 mM) from day 1 to day 3 in vitro. The graph in D shows the axon length in nucleofected neurons (GFP-positive) incubated in the presence or absence of ADP. (F–H) Hippocampal neurons nucleofected with scrambled shRNA, P2Y1 shRNA or P2Y13 shRNA and treated with the P2Y1 antagonist (MRS-2179) or the P2Y13 antagonist (MRS-2211) from day 1 to day 3 in vitro. Scale bars: 50 mm. Note that in all cases P2Y1 expression and function is necessary for axon elongation. Data in G are the mean axon lengths ± s.e.m. from three independent experiments, analyzing 100 neurons for each condition in each experiment; ***P,0.001. H shows the distribution of the axon length for all neurons from three independent experiments for each condition (n5300). (I) Hippocampal neurons that had been nucleofected with plasmids expressing GFP, P2Y1–GFP and P2Y13. After 3 DIV neurons were stained for MAP2 and Tau-1 to identify the axon. (J) P2Y1 or P2Y13 mean fluorescence intensity along the axon in control, scrambled shRNA, P2Y1 shRNA or P2Y13 shRNA nucleofected neurons. (K) Graph of the mean axon lengths ± s.e.m. of neurons nucleofected with GFP, P2Y1–GFP or P2Y13 and GFP. Neurons were quantified in three independent experiments, analyzing 100 neurons for each condition in each experiment; ***P,0.001. Scale bars: 100 mm. Box-plot shows the distribution of axon lengths for all the neurons quantified in K.

Journal: Journal of cell science

Article Title: Adenylate cyclase 5 coordinates the action of ADP, P2Y1, P2Y13 and ATP-gated P2X7 receptors on axonal elongation.

doi: 10.1242/jcs.091736

Figure Lengend Snippet: Fig. 3. P2Y1 silencing impairs ADP-dependent axon elongation. (A) Hippocampal neurons were nucleofected with scrambled shRNA, P2Y1 shRNA or P2Y13 shRNA. Neurons were fixed at 3 DIV and stained with an anti-a-tubulin antibody. Nucleofected neurons were identified by their GFP fluorescence. (B) HEK- 293T cells were co-transfected with GFP, P2Y1–GFP or P2Y13 plasmids, in combination with different P2Y1 or P2Y13 shRNAs. Data are means ± s.e.m. of three independent experiments. P2Y1–GFP and P2Y13 protein expression was normalized to a-tubulin expression levels; ***P,0.001. (C) Axon length of hippocampal neurons expressing scrambled shRNA, two different P2Y1 shRNAs or two different P2Y13 shRNAs was quantified after staining with antibodies against MAP2 and Tau-1. Data are mean axon lengths ± s.e.m. from three independent experiments, analyzing 100 neurons for each condition in each experiment; ***P,0.001. The dotted grey line indicates the mean axon length of scrambled-shRNA-nucleofected neurons. (D,E) Hippocampal neurons nucleofected with scrambled shRNA or P2Y1 shRNA and treated with ADP (5 mM) from day 1 to day 3 in vitro. The graph in D shows the axon length in nucleofected neurons (GFP-positive) incubated in the presence or absence of ADP. (F–H) Hippocampal neurons nucleofected with scrambled shRNA, P2Y1 shRNA or P2Y13 shRNA and treated with the P2Y1 antagonist (MRS-2179) or the P2Y13 antagonist (MRS-2211) from day 1 to day 3 in vitro. Scale bars: 50 mm. Note that in all cases P2Y1 expression and function is necessary for axon elongation. Data in G are the mean axon lengths ± s.e.m. from three independent experiments, analyzing 100 neurons for each condition in each experiment; ***P,0.001. H shows the distribution of the axon length for all neurons from three independent experiments for each condition (n5300). (I) Hippocampal neurons that had been nucleofected with plasmids expressing GFP, P2Y1–GFP and P2Y13. After 3 DIV neurons were stained for MAP2 and Tau-1 to identify the axon. (J) P2Y1 or P2Y13 mean fluorescence intensity along the axon in control, scrambled shRNA, P2Y1 shRNA or P2Y13 shRNA nucleofected neurons. (K) Graph of the mean axon lengths ± s.e.m. of neurons nucleofected with GFP, P2Y1–GFP or P2Y13 and GFP. Neurons were quantified in three independent experiments, analyzing 100 neurons for each condition in each experiment; ***P,0.001. Scale bars: 100 mm. Box-plot shows the distribution of axon lengths for all the neurons quantified in K.

Article Snippet: The adenylate cyclase 5 interference shRNAs (79 and 84) and control scrambled shRNA were purchased from Origene (TG506651).

Techniques: shRNA, Staining, Fluorescence, Transfection, Expressing, In Vitro, Incubation, Control

Fig. 5. Adenylate cyclase activity is necessary for ADP–P2Y1-dependent axon elongation. (A) Hippocampal neurons treated with the indicated compounds from day 1 to day 3 in vitro and stained for MAP2 and Tau-1. Scale bar: 100 mm. (B) Axon length in neurons treated with vehicle (black bars) or the indicated adenylate cyclase or cAMP regulators (white bars), in combination with agonists or antagonists of P2Y1 or P2Y13. Graphs represent the mean axon length ± s.e.m. from three independent experiments, analyzing 100 neurons for each condition in each experiment; ***P,0.001, **P,0.01; n.s., not significant. (C,E) Hippocampal neurons nucleofected with P2Y1 shRNA and stained at 3 DIV for Tau-1 or a-tubulin (red). Nucleofected neurons were identified by GFP fluorescence. Neurons were treated with the adenylate cyclase activator forskolin (5 mM) or a PDE4 inhibitor (20 nM). Note that both treatments reversed the negative effects of P2Y1 silencing or P2Y13 expression on axon elongation. The graphs in E show the axonal lengths ± s.e.m. from three independent experiments, analyzing 100 GFP positive neurons for each condition in each experiment; ***P,0.001. (D,F) Neurons nucleofected with P2X7 shRNA or P2X7– GFP expression plasmids and treated from day 1 to day 3 in vitro with the adenylate cyclase inhibitor (SQ-22536) or the adenylate cyclase activator forskolin, respectively. Note that adenylate cyclase activation or increased cAMP levels reversed the negative effect of P2X7–GFP expression on axon elongation. The graphs in F show the axon length ± s.e.m. from three independent experiments analyzing 100 neurons for each condition in each experiment; ***P,0.001. Scale bars: 100 mm.

Journal: Journal of cell science

Article Title: Adenylate cyclase 5 coordinates the action of ADP, P2Y1, P2Y13 and ATP-gated P2X7 receptors on axonal elongation.

doi: 10.1242/jcs.091736

Figure Lengend Snippet: Fig. 5. Adenylate cyclase activity is necessary for ADP–P2Y1-dependent axon elongation. (A) Hippocampal neurons treated with the indicated compounds from day 1 to day 3 in vitro and stained for MAP2 and Tau-1. Scale bar: 100 mm. (B) Axon length in neurons treated with vehicle (black bars) or the indicated adenylate cyclase or cAMP regulators (white bars), in combination with agonists or antagonists of P2Y1 or P2Y13. Graphs represent the mean axon length ± s.e.m. from three independent experiments, analyzing 100 neurons for each condition in each experiment; ***P,0.001, **P,0.01; n.s., not significant. (C,E) Hippocampal neurons nucleofected with P2Y1 shRNA and stained at 3 DIV for Tau-1 or a-tubulin (red). Nucleofected neurons were identified by GFP fluorescence. Neurons were treated with the adenylate cyclase activator forskolin (5 mM) or a PDE4 inhibitor (20 nM). Note that both treatments reversed the negative effects of P2Y1 silencing or P2Y13 expression on axon elongation. The graphs in E show the axonal lengths ± s.e.m. from three independent experiments, analyzing 100 GFP positive neurons for each condition in each experiment; ***P,0.001. (D,F) Neurons nucleofected with P2X7 shRNA or P2X7– GFP expression plasmids and treated from day 1 to day 3 in vitro with the adenylate cyclase inhibitor (SQ-22536) or the adenylate cyclase activator forskolin, respectively. Note that adenylate cyclase activation or increased cAMP levels reversed the negative effect of P2X7–GFP expression on axon elongation. The graphs in F show the axon length ± s.e.m. from three independent experiments analyzing 100 neurons for each condition in each experiment; ***P,0.001. Scale bars: 100 mm.

Article Snippet: The adenylate cyclase 5 interference shRNAs (79 and 84) and control scrambled shRNA were purchased from Origene (TG506651).

Techniques: Activity Assay, In Vitro, Staining, shRNA, Fluorescence, Expressing, Activation Assay

Fig. 6. Adenylate cyclase 5 activity is required for proper axonal elongation in response to ADP or P2X7 inhibition. (A,D) Hippocampal neurons cultured from day 1 to day 3 in vitro in the presence or absence of the PKCf inhibitor, PKCf pseudosubstrate (10 mM) in combination with ADP 5 mM, BBG 100 nM, MRS-2211 5 mM or forskolin 5 mM. Neurons were stained with anti-MAP2 and anti-Tau-1 antibodies. Graph in D shows the mean axonal lengths ± s.e.m. from three independent experiments. (B) Distribution of adenylate cyclase 5 in hippocampal neurons at 3 DIV. Arrow indicates the AC5 in the distal region of the axon. Right panels show the distal region of the axon stained for AC5 and F-actin. Scale bar: 100 mm. (C) Hippocampal neurons treated from day 1 to day 3 in vitro with ADP (5 mM) in the presence or absence of the adenylate cyclase 5 inhibitor NY80 (10 mM). Scale bar: 100 mm. (E) Mean axon lengths ± s.e.m. of 3 DIV neurons treated with vehicle (black bars) or NKY80 (white bars), in combination with ADP (5 mM), the P2Y13 antagonist MRS-2211, dbcAMP (2 mM), rPMT or PTX. Note that addition of dbcAMP impaired the inhibitory effect of NKY80 on axon growth; ***P,0.001. Data are from three independent experiments analyzing 100 neurons for each condition in each experiment. (F,H) Neurons nucleofected with GFP, P2Y1–GFP, scrambled shRNA, P2X7 shRNA or P2Y13 shRNA were cultured from day 1 to day 3 in vitro with vehicle or the adenylate cyclase 5 inhibitor, NKY80. (F) Representative images of these neurons. (H) Mean axonal lengths ± s.e.m. from three independent experiments analyzing 100 neurons for each condition in each experiment; ***P,0.001. (G,I) Neurons were nucleofected with scrambled shRNA or AC5 shRNA. (G) Representative images of 3 DIV neurons. (I) Mean axon length ± s.e.m. of neurons shown in G cultured in the presence of the indicated compounds at the concentrations shown previously. Scale bars: 100 mm.

Journal: Journal of cell science

Article Title: Adenylate cyclase 5 coordinates the action of ADP, P2Y1, P2Y13 and ATP-gated P2X7 receptors on axonal elongation.

doi: 10.1242/jcs.091736

Figure Lengend Snippet: Fig. 6. Adenylate cyclase 5 activity is required for proper axonal elongation in response to ADP or P2X7 inhibition. (A,D) Hippocampal neurons cultured from day 1 to day 3 in vitro in the presence or absence of the PKCf inhibitor, PKCf pseudosubstrate (10 mM) in combination with ADP 5 mM, BBG 100 nM, MRS-2211 5 mM or forskolin 5 mM. Neurons were stained with anti-MAP2 and anti-Tau-1 antibodies. Graph in D shows the mean axonal lengths ± s.e.m. from three independent experiments. (B) Distribution of adenylate cyclase 5 in hippocampal neurons at 3 DIV. Arrow indicates the AC5 in the distal region of the axon. Right panels show the distal region of the axon stained for AC5 and F-actin. Scale bar: 100 mm. (C) Hippocampal neurons treated from day 1 to day 3 in vitro with ADP (5 mM) in the presence or absence of the adenylate cyclase 5 inhibitor NY80 (10 mM). Scale bar: 100 mm. (E) Mean axon lengths ± s.e.m. of 3 DIV neurons treated with vehicle (black bars) or NKY80 (white bars), in combination with ADP (5 mM), the P2Y13 antagonist MRS-2211, dbcAMP (2 mM), rPMT or PTX. Note that addition of dbcAMP impaired the inhibitory effect of NKY80 on axon growth; ***P,0.001. Data are from three independent experiments analyzing 100 neurons for each condition in each experiment. (F,H) Neurons nucleofected with GFP, P2Y1–GFP, scrambled shRNA, P2X7 shRNA or P2Y13 shRNA were cultured from day 1 to day 3 in vitro with vehicle or the adenylate cyclase 5 inhibitor, NKY80. (F) Representative images of these neurons. (H) Mean axonal lengths ± s.e.m. from three independent experiments analyzing 100 neurons for each condition in each experiment; ***P,0.001. (G,I) Neurons were nucleofected with scrambled shRNA or AC5 shRNA. (G) Representative images of 3 DIV neurons. (I) Mean axon length ± s.e.m. of neurons shown in G cultured in the presence of the indicated compounds at the concentrations shown previously. Scale bars: 100 mm.

Article Snippet: The adenylate cyclase 5 interference shRNAs (79 and 84) and control scrambled shRNA were purchased from Origene (TG506651).

Techniques: Activity Assay, Inhibition, Cell Culture, In Vitro, Staining, shRNA

( A and B ) Quantitative proteomic analysis of the mouse cerebrum. (A) Proteomic analysis of the mouse cerebrum and a volcano plot illustrating down-regulated (blue) and up-regulated (red) proteins in the cerebra of 6-month-old 5×FAD; Usp25 −/− versus 5×FAD mice (fold change > 1.1, P < 0.05). n = 3 samples per group; each sample is a pool of three cerebra from the same genotype. (B) GO analysis of down-regulated proteins in 5×FAD; Usp25 −/− mice relative to 5×FAD mice. ( C ) Primary microglia from WT mice were transfected with siAtp6v0c or control siRNA (siNC) for 48 hours and subsequently treated with 10 μM oAβ 42 or vehicle control along with pHrodo Red–labeled synaptosomes (Syn) for another 24 hours, and the phagocytosis abilities of microglia were quantified on the basis of the pHrodo Red intensity in Iba1 + cells. Scale bar, 25 μm. n = 3 independent experiments; n = 207 to 211 cells per group were counted. ( D and E ) Coimmunoprecipitation (IP) between exogenously expressed USP25a-myc and HA-ATP6V0C (D) or HA-WDFY1 (E) proteins. ( F and G ) Immunoblot (IB) analysis of polyubiquitinated HA-ATP6V0C (F) and HA-WDFY1 (G) in HEK293T cells upon USP25 knockdown. n = 6. All data represent means ± SEM. P values were determined by the Kruskal-Wallis test with Dunn’s post hoc analysis in (C) and by the Mann-Whitney test in (F) and (G). * P < 0.05; ** P < 0.01; **** P < 0.0001.

Journal: Science Advances

Article Title: Trisomy 21–induced dysregulation of microglial homeostasis in Alzheimer’s brains is mediated by USP25

doi: 10.1126/sciadv.abe1340

Figure Lengend Snippet: ( A and B ) Quantitative proteomic analysis of the mouse cerebrum. (A) Proteomic analysis of the mouse cerebrum and a volcano plot illustrating down-regulated (blue) and up-regulated (red) proteins in the cerebra of 6-month-old 5×FAD; Usp25 −/− versus 5×FAD mice (fold change > 1.1, P < 0.05). n = 3 samples per group; each sample is a pool of three cerebra from the same genotype. (B) GO analysis of down-regulated proteins in 5×FAD; Usp25 −/− mice relative to 5×FAD mice. ( C ) Primary microglia from WT mice were transfected with siAtp6v0c or control siRNA (siNC) for 48 hours and subsequently treated with 10 μM oAβ 42 or vehicle control along with pHrodo Red–labeled synaptosomes (Syn) for another 24 hours, and the phagocytosis abilities of microglia were quantified on the basis of the pHrodo Red intensity in Iba1 + cells. Scale bar, 25 μm. n = 3 independent experiments; n = 207 to 211 cells per group were counted. ( D and E ) Coimmunoprecipitation (IP) between exogenously expressed USP25a-myc and HA-ATP6V0C (D) or HA-WDFY1 (E) proteins. ( F and G ) Immunoblot (IB) analysis of polyubiquitinated HA-ATP6V0C (F) and HA-WDFY1 (G) in HEK293T cells upon USP25 knockdown. n = 6. All data represent means ± SEM. P values were determined by the Kruskal-Wallis test with Dunn’s post hoc analysis in (C) and by the Mann-Whitney test in (F) and (G). * P < 0.05; ** P < 0.01; **** P < 0.0001.

Article Snippet: HEK293T cells transfected with siUSP25 or control siRNA were incubated with lysosomal inhibitor leupeptin (100 μg ml −1 ) (MCE, Monmouth Junction, NJ, USA; HY-18234A) or 10 μM proteasomal inhibitor MG132 (MCE, HY-13259).

Techniques: Transfection, Control, Labeling, Western Blot, Knockdown, MANN-WHITNEY

Fig. 5. Effects of plasmin on PDGF-D induced inflammation. The plasmin antagonist (EACA) decreased ICH induced production of PDGF-D and p-PDGFRβ increases 24 h after ICH (A, #p b 0.05 vs sham. *p b 0.05 vs ICH. n = 6 mice per group), resulting in decreased microglia activation (B). Injection of the recombinant plasmin induced significant production of the PDGF-D in ipsilateral hemisphere (C, #p b 0.05 vs sham, @p b 0.05 vs contralateral. n = 6 mice per group). Increased MPO levels (D) were also observed after plasmin injection. While scrambled RNA has no effect, PDGF-D siRNA attenuated plasmin induced increase of MPO production (D, #p b 0.05 vs sham. αp b 0.05 vs Plasmin. n = 6 mice per group). Error bars represent mean ± standard error of the mean. Scale bar = 50um.

Journal: Experimental neurology

Article Title: Role of PDGF-D and PDGFR-β in neuroinflammation in experimental ICH mice model.

doi: 10.1016/j.expneurol.2016.06.010

Figure Lengend Snippet: Fig. 5. Effects of plasmin on PDGF-D induced inflammation. The plasmin antagonist (EACA) decreased ICH induced production of PDGF-D and p-PDGFRβ increases 24 h after ICH (A, #p b 0.05 vs sham. *p b 0.05 vs ICH. n = 6 mice per group), resulting in decreased microglia activation (B). Injection of the recombinant plasmin induced significant production of the PDGF-D in ipsilateral hemisphere (C, #p b 0.05 vs sham, @p b 0.05 vs contralateral. n = 6 mice per group). Increased MPO levels (D) were also observed after plasmin injection. While scrambled RNA has no effect, PDGF-D siRNA attenuated plasmin induced increase of MPO production (D, #p b 0.05 vs sham. αp b 0.05 vs Plasmin. n = 6 mice per group). Error bars represent mean ± standard error of the mean. Scale bar = 50um.

Article Snippet: Experiment 5: The PDGF-D siRNAs mixture or scramble siRNA (100 pmol in 2 μl, OriGene) was administered intraventricularly 24 h before plasmin was injected into the right basal ganglia in naïve mice.

Techniques: Activation Assay, Injection, Recombinant

PFN1 is correlated with NSCLC metastasis and could promote NSCLC cell migration in vitro . (A) Representative IHC images of PFN1 expression on the NSCLC tissues. (B) The staining index of PFN1 on the tissue chip. ** p < 0.01. (C) Representative IHC images of PFN1 expression on the tissue chip. (D) The expression of PFN1 in TCGA LUAD data. ** p < 0.01. (E) The Kaplan–Meier survival analysis of PFN1 in NSCLC patients. (Data source: TCGA LUAD dataset) (F,G) Wound healing assays conducted to evaluate the migration ability of PFN1 -overexpressing (F) and PFN1 knockdown (KD) (G) H1299 cells. ** p < 0.01; scale bar, 500 μm. (H,I) Transwell migration assays conducted to evaluate the migration of PFN1 -overexpressing (H) and PFN1 KD (I) H1299 cells. ** p < 0.01; scale bar, 500 μm. EV, empty vector; OE, PFN1 overexpression; NC, negative control; si-1/ 2, PFN1 siRNA1 1/2.

Journal: Frontiers in Pharmacology

Article Title: Profilin 1 Induces Tumor Metastasis by Promoting Microvesicle Secretion Through the ROCK 1/p-MLC Pathway in Non-Small Cell Lung Cancer

doi: 10.3389/fphar.2022.890891

Figure Lengend Snippet: PFN1 is correlated with NSCLC metastasis and could promote NSCLC cell migration in vitro . (A) Representative IHC images of PFN1 expression on the NSCLC tissues. (B) The staining index of PFN1 on the tissue chip. ** p < 0.01. (C) Representative IHC images of PFN1 expression on the tissue chip. (D) The expression of PFN1 in TCGA LUAD data. ** p < 0.01. (E) The Kaplan–Meier survival analysis of PFN1 in NSCLC patients. (Data source: TCGA LUAD dataset) (F,G) Wound healing assays conducted to evaluate the migration ability of PFN1 -overexpressing (F) and PFN1 knockdown (KD) (G) H1299 cells. ** p < 0.01; scale bar, 500 μm. (H,I) Transwell migration assays conducted to evaluate the migration of PFN1 -overexpressing (H) and PFN1 KD (I) H1299 cells. ** p < 0.01; scale bar, 500 μm. EV, empty vector; OE, PFN1 overexpression; NC, negative control; si-1/ 2, PFN1 siRNA1 1/2.

Article Snippet: PFN1 siRNA and control scramble siRNA were synthesized by Guangzhou RiboBio Co. (Guangzhou, China), and the sequences are listed in .

Techniques: Migration, In Vitro, Expressing, Staining, Knockdown, Plasmid Preparation, Over Expression, Negative Control

PFN1 could promote MVs secretion in NSCLC. (A) Heatmap of differentially expressed proteins between EV and PFN1 OE cells. (B) GO enrichment analysis of differentially expressed proteins. (C) COG/KOG analysis of differentially expressed proteins. (D) MVs extracted from EV-expressing and PFN1 -overexpressing cells, using continuous differential centrifugation, identified using transmission electron microscopy. Scale bar, 100 nm. (E,F) Flow cytometry (E) and western blotting (F) were used to quantify MVs in PFN1 -overexpressing and EV-expressing cells. ARF6 and actin were used as MV markers. (G) Expression of PFN1 and annexin A1 in lung tumor tissues detected using immunofluorescence. (H) The staining index of p-MLC on the tissue chip. ** p < 0.01. (I) Representative IHC images of p-MLC expression. (J) Spearman rank correlation analysis was used to assess the relationship between PFN1 and p-MLC expression on the tissue chip; p and r values are shown in the plot.

Journal: Frontiers in Pharmacology

Article Title: Profilin 1 Induces Tumor Metastasis by Promoting Microvesicle Secretion Through the ROCK 1/p-MLC Pathway in Non-Small Cell Lung Cancer

doi: 10.3389/fphar.2022.890891

Figure Lengend Snippet: PFN1 could promote MVs secretion in NSCLC. (A) Heatmap of differentially expressed proteins between EV and PFN1 OE cells. (B) GO enrichment analysis of differentially expressed proteins. (C) COG/KOG analysis of differentially expressed proteins. (D) MVs extracted from EV-expressing and PFN1 -overexpressing cells, using continuous differential centrifugation, identified using transmission electron microscopy. Scale bar, 100 nm. (E,F) Flow cytometry (E) and western blotting (F) were used to quantify MVs in PFN1 -overexpressing and EV-expressing cells. ARF6 and actin were used as MV markers. (G) Expression of PFN1 and annexin A1 in lung tumor tissues detected using immunofluorescence. (H) The staining index of p-MLC on the tissue chip. ** p < 0.01. (I) Representative IHC images of p-MLC expression. (J) Spearman rank correlation analysis was used to assess the relationship between PFN1 and p-MLC expression on the tissue chip; p and r values are shown in the plot.

Article Snippet: PFN1 siRNA and control scramble siRNA were synthesized by Guangzhou RiboBio Co. (Guangzhou, China), and the sequences are listed in .

Techniques: Expressing, Centrifugation, Transmission Assay, Electron Microscopy, Flow Cytometry, Western Blot, Immunofluorescence, Staining

MVs derived from PFN1 OE cells promote migration in NSCLC cells. (A) MVs collected from sera of patients with NSCLC quantified using flow cytometry. ** p < 0.01. (B) Protein expression of ARF6 and β-actin in MVs collected from sera of patients with NSCLC detected using western blotting. (C) Effect of PFN1 -overexpressing cell supernatants on cell migration evaluated through wound healing assays. ** p < 0.01; scale bar, 500 μm. (D) PKH67-labeled MVs taken up by H1299 cells. DAPI was used to stain the nuclei of H1299 cells. Scale bar, 500 μm. (E,F) Wound healing (E) and Transwell migration (F) assays conducted to evaluate the migration of H1299 cells after treatment with MVs derived from EV-expressing and PFN1 -overexpressing cells; ** p < 0.01; scale bar, 500 μm.

Journal: Frontiers in Pharmacology

Article Title: Profilin 1 Induces Tumor Metastasis by Promoting Microvesicle Secretion Through the ROCK 1/p-MLC Pathway in Non-Small Cell Lung Cancer

doi: 10.3389/fphar.2022.890891

Figure Lengend Snippet: MVs derived from PFN1 OE cells promote migration in NSCLC cells. (A) MVs collected from sera of patients with NSCLC quantified using flow cytometry. ** p < 0.01. (B) Protein expression of ARF6 and β-actin in MVs collected from sera of patients with NSCLC detected using western blotting. (C) Effect of PFN1 -overexpressing cell supernatants on cell migration evaluated through wound healing assays. ** p < 0.01; scale bar, 500 μm. (D) PKH67-labeled MVs taken up by H1299 cells. DAPI was used to stain the nuclei of H1299 cells. Scale bar, 500 μm. (E,F) Wound healing (E) and Transwell migration (F) assays conducted to evaluate the migration of H1299 cells after treatment with MVs derived from EV-expressing and PFN1 -overexpressing cells; ** p < 0.01; scale bar, 500 μm.

Article Snippet: PFN1 siRNA and control scramble siRNA were synthesized by Guangzhou RiboBio Co. (Guangzhou, China), and the sequences are listed in .

Techniques: Derivative Assay, Migration, Flow Cytometry, Expressing, Western Blot, Labeling, Staining

PFN1 promotes in vivo NSCLC metastasis by elevating MV secretion. (A) Schematic illustration of the mouse model of metastatic tumor established to determine the role of PFN1 in tumor metastasis. (B) Body weight changes in mice after intracardiac injection of PFN1 -overexpressing and EV-expressing cell lines. (C,D) Representative images of lung (C) and liver (D) metastases of the mouse model. The number of metastases is displayed in the right-hand side graph. * p < 0.05, ** p < 0.01. (E) Representative images of HE-stained lung tissues of the mouse model. (F) Representative IHC images of PFN1 and p-MLC expression in lung tissues. The staining index is shown in the right-hand side graph. ** p < 0.01. (G) Representative images of HE-stained liver tissues of the mouse model. (H) Representative IHC images of PFN1 and p-MLC expression in liver tissues. The staining index is shown in the right-hand side graph. ** p < 0.01. (I) Body weight changes in mice after intracardiac injection of H1299 cells and MVs. (J) Representative images of lung metastases of the mouse model. The number of metastases is shown in the bottom graph. * p < 0.05. (K) Representative images of HE-stained lung tissues of the mouse model. (L) Representative IHC images of PFN1 and p-MLC expression in lung tissues. The staining index is shown in the right-hand side graph; * p < 0.05.

Journal: Frontiers in Pharmacology

Article Title: Profilin 1 Induces Tumor Metastasis by Promoting Microvesicle Secretion Through the ROCK 1/p-MLC Pathway in Non-Small Cell Lung Cancer

doi: 10.3389/fphar.2022.890891

Figure Lengend Snippet: PFN1 promotes in vivo NSCLC metastasis by elevating MV secretion. (A) Schematic illustration of the mouse model of metastatic tumor established to determine the role of PFN1 in tumor metastasis. (B) Body weight changes in mice after intracardiac injection of PFN1 -overexpressing and EV-expressing cell lines. (C,D) Representative images of lung (C) and liver (D) metastases of the mouse model. The number of metastases is displayed in the right-hand side graph. * p < 0.05, ** p < 0.01. (E) Representative images of HE-stained lung tissues of the mouse model. (F) Representative IHC images of PFN1 and p-MLC expression in lung tissues. The staining index is shown in the right-hand side graph. ** p < 0.01. (G) Representative images of HE-stained liver tissues of the mouse model. (H) Representative IHC images of PFN1 and p-MLC expression in liver tissues. The staining index is shown in the right-hand side graph. ** p < 0.01. (I) Body weight changes in mice after intracardiac injection of H1299 cells and MVs. (J) Representative images of lung metastases of the mouse model. The number of metastases is shown in the bottom graph. * p < 0.05. (K) Representative images of HE-stained lung tissues of the mouse model. (L) Representative IHC images of PFN1 and p-MLC expression in lung tissues. The staining index is shown in the right-hand side graph; * p < 0.05.

Article Snippet: PFN1 siRNA and control scramble siRNA were synthesized by Guangzhou RiboBio Co. (Guangzhou, China), and the sequences are listed in .

Techniques: In Vivo, Injection, Expressing, Staining

Mechanisms underlying the promotion of MLC phosphorylation by PFN1. (A,B) Protein expression after PFN1 overexpression (A) and knockdown (B) measured using western blotting. (C) Protein expression in PFN1 mutants measured using western blotting. (D) PFN1 interactions with ROCK1/2 confirmed using co-IP. (E) Protein expression after treatment with Y27632 (10 µM) measured using western blotting. (F) Effect of PFN1 on ROCK1 activity. ** p < 0.01. (G) Effect of PFN1 on ROCK2 activity. (H) Flow cytometry measuring changes in the amount of MVs after treatment with Y27632; * p < 0.05.

Journal: Frontiers in Pharmacology

Article Title: Profilin 1 Induces Tumor Metastasis by Promoting Microvesicle Secretion Through the ROCK 1/p-MLC Pathway in Non-Small Cell Lung Cancer

doi: 10.3389/fphar.2022.890891

Figure Lengend Snippet: Mechanisms underlying the promotion of MLC phosphorylation by PFN1. (A,B) Protein expression after PFN1 overexpression (A) and knockdown (B) measured using western blotting. (C) Protein expression in PFN1 mutants measured using western blotting. (D) PFN1 interactions with ROCK1/2 confirmed using co-IP. (E) Protein expression after treatment with Y27632 (10 µM) measured using western blotting. (F) Effect of PFN1 on ROCK1 activity. ** p < 0.01. (G) Effect of PFN1 on ROCK2 activity. (H) Flow cytometry measuring changes in the amount of MVs after treatment with Y27632; * p < 0.05.

Article Snippet: PFN1 siRNA and control scramble siRNA were synthesized by Guangzhou RiboBio Co. (Guangzhou, China), and the sequences are listed in .

Techniques: Phospho-proteomics, Expressing, Over Expression, Knockdown, Western Blot, Co-Immunoprecipitation Assay, Activity Assay, Flow Cytometry

ROCK1 inhibitor Y27632 partially reversed the promotion of lung cancer metastasis by PFN1 in vitro and in vivo . (A,B) Wound healing assays conducted to evaluate the effect of Y27632 (A) and Y27632 combined with MVs (B) on cell migration. ** p < 0.01; scale bar, 500 μm. (C) Transwell migration assays conducted to evaluate the effect of Y27632 and Y27632 combined with MVs on cell migration. ** p < 0.01; scale bar, 500 μm. (D) Schematic diagram of the mouse model of metastatic tumor established to determine the effect of Y27632 on PFN1-induced lung cancer metastasis. (E) Body weight changes in mice after intracardiac injection of PFN1 -overexpressing H1299 cells and intraperitoneal injection of Y27632 (10 mg/kg). (F) Representative images of lung and liver metastatic tissue in mice. The number of metastatic nodules is shown in the right-hand side graph. * p < 0.05. (G,H) Representative images of HE-stained lung (G) and liver (H) metastases. (I) Representative IHC images of PFN1 and p-MLC expression in lung tissues. The staining index is shown in the right-hand side graph. ** p < 0.01. (J) Representative IHC images of PFN1 and p-MLC expression in liver tissues. The staining index is shown in the right-hand side graph; ** p < 0.01.

Journal: Frontiers in Pharmacology

Article Title: Profilin 1 Induces Tumor Metastasis by Promoting Microvesicle Secretion Through the ROCK 1/p-MLC Pathway in Non-Small Cell Lung Cancer

doi: 10.3389/fphar.2022.890891

Figure Lengend Snippet: ROCK1 inhibitor Y27632 partially reversed the promotion of lung cancer metastasis by PFN1 in vitro and in vivo . (A,B) Wound healing assays conducted to evaluate the effect of Y27632 (A) and Y27632 combined with MVs (B) on cell migration. ** p < 0.01; scale bar, 500 μm. (C) Transwell migration assays conducted to evaluate the effect of Y27632 and Y27632 combined with MVs on cell migration. ** p < 0.01; scale bar, 500 μm. (D) Schematic diagram of the mouse model of metastatic tumor established to determine the effect of Y27632 on PFN1-induced lung cancer metastasis. (E) Body weight changes in mice after intracardiac injection of PFN1 -overexpressing H1299 cells and intraperitoneal injection of Y27632 (10 mg/kg). (F) Representative images of lung and liver metastatic tissue in mice. The number of metastatic nodules is shown in the right-hand side graph. * p < 0.05. (G,H) Representative images of HE-stained lung (G) and liver (H) metastases. (I) Representative IHC images of PFN1 and p-MLC expression in lung tissues. The staining index is shown in the right-hand side graph. ** p < 0.01. (J) Representative IHC images of PFN1 and p-MLC expression in liver tissues. The staining index is shown in the right-hand side graph; ** p < 0.01.

Article Snippet: PFN1 siRNA and control scramble siRNA were synthesized by Guangzhou RiboBio Co. (Guangzhou, China), and the sequences are listed in .

Techniques: In Vitro, In Vivo, Migration, Injection, Staining, Expressing

Schematic diagram of the role of PFN1 in NSCLC metastasis. In the initiation stage of NSCLC, cells with upregulated PFN1 secret more MVs through PFN1 interactions with the ROCK/p-MLC pathway. These MVs contain numerous oncogenenic moleculars, which could enhance migration abilities of PFN1 normal expressed NSCLC cells, and untimately promote progression and metastasis of NSCLC.

Journal: Frontiers in Pharmacology

Article Title: Profilin 1 Induces Tumor Metastasis by Promoting Microvesicle Secretion Through the ROCK 1/p-MLC Pathway in Non-Small Cell Lung Cancer

doi: 10.3389/fphar.2022.890891

Figure Lengend Snippet: Schematic diagram of the role of PFN1 in NSCLC metastasis. In the initiation stage of NSCLC, cells with upregulated PFN1 secret more MVs through PFN1 interactions with the ROCK/p-MLC pathway. These MVs contain numerous oncogenenic moleculars, which could enhance migration abilities of PFN1 normal expressed NSCLC cells, and untimately promote progression and metastasis of NSCLC.

Article Snippet: PFN1 siRNA and control scramble siRNA were synthesized by Guangzhou RiboBio Co. (Guangzhou, China), and the sequences are listed in .

Techniques: Migration